» Home » Making » Page 1
Making controller to look for properties from inheriting viewmodels - Test Making Engine
Category : Programming Languages

In my project I have to write the test engine, which will read test tasks from file, and make view, where people will answer:


One test has many tasks (list of tasks).
There are 4 types of tasks: radiobutton, checkbox, combobox, oneanswer.
In view all tasks from test will be listed.

I've written part which reads from file and creates view, but I have problems with rece


View Replies


making a simple search function, making the cursor jump to (or highlight) the word that is searched for
Category : Programming Languages

I have now used way too long time, trying to figure out a problem, which I didn't think would be that hard.


Here is the deal:


I am writing a small application using C# and WPF.


I have a RichTextBox containing a FlowDocument.


I have added a small textbox and a button below my richtextbox.


The user then types in the word he/she wishes to


View Replies


Ideas for Making Money by Making Things Out of Wood
Category : Hobbies, Games & Toys
If you are the creative type, a carpenter or are good with tools, making money by making things out of wood should be no problem. Some projects require few tools and are simple, while others are quite involved. Find your specialty and get to work. Give yourself a supplemental income or make enough to replace a lost paycheck by selling items made out of wood. FurniturePeople around the world use

View Replies


Information About Doll Making & Clothes Making
Category : Hobbies, Games & Toys
As early as the 1400s, the English were importing French dolls dressed in the latest Parisian fashions. Wood was one of the first materials used in doll making. Since most dolls were customarily clothed, the extremities were most appealing, especially the head. Carving wood developed into a sophisticated and expensive craft. As a result, doll makers throughout history explored a variety of materia

View Replies


Python - making counters, making loops?
Category : Programming Languages

I am having some trouble with a piece of code below:


Input: li is a nested list as below:


li = [['>0123456789 mouse gene 1
', 'ATGTTGGGTT/CTTAGTTG
', 'ATGGGGTTCCT/A
'], ['>9876543210 mouse gene 2
', 'ATTTGGTTTCCT
', 'ATTCAATTTTAAGGGGGGGG
']]

Using the function below, my desired output is simply the 2nd to the


View Replies


making SQL more efficiency by making two queries into one instead of having a loop
Category : Databases

I have the following code and was wondering how I could simplify it into one MYSQL statement


$sql = "SELECT sesionID
FROM `juegos_sesiones`
WHERE `usuarioID` = ".$_SESSION['MM_UserID'];
$query = mysql_query($sql, $cnx) or die(mysql_error());
//$row_rsPaises = mysql_fetch_assoc($rsPaises);
$exercises = mysql_num_rows($query);
echo $exercises;

View Replies


Making a Word document with PHP and making it read-only?
Category : PHP

I use this guide to make Word documents using PHP and I use the HTML version in the guide since um using Linux:http://cutt.us/NBzX


Problem is that I need to generate read-only documents and Im having a headace making one...


Any ideas how to make the files read-only??


Thanks in advance


View Replies


What Is the Difference Between Managerial Decision-Making & Strategic Decision-Making?
Category : Business
Companies make decisions throughout normal business operations. These businesses use financial, marketing and operational data to make the decisions. These decisions include both managerial decision-making, such as production scheduling or offering customer discounts, and strategic decision-making, which includes decisions such as business expansion or pursuing a merger. Companies need to understa

View Replies


Making a sub in VBA
Category : Programming Languages

How could I write a program in VBA, that scans a cell range in excel(2010), than tells how many cells it scanned, and were there more numeric or text cells, and how many empty cells it found? The range cell would be defined by the user.


This is my current code:


Private Sub CommandButton1_Click()
Dim c As Range
Set c = Application.InputBox(Prompt:="A vizsgál

View Replies

TAGS : Making

Making a new map
Category : Programming Languages

Today I took a crack at making a little platformer in pygame. I used a lot of code from a very nifty and helpful tutorial, because I didn't know exactly how to do it.


So far, a map is made by processing a 32x32 portion of the screen and assigning it a block type, based on the character in the map text portion. So far I have a platform block, a border block, and an exit block that I


View Replies

TAGS : Making

Next
2012 / 2017 Copyrights BigHow , All Rights Reserved .