» Home » Making » Page 1
Making controller to look for properties from inheriting viewmodels - Test Making Engine
by Xander in Programming Languages

In my project I have to write the test engine, which will read test tasks from file, and make view, where people will answer:


One test has many tasks (list of tasks).
There are 4 types of tasks: radiobutton, checkbox, combobox, oneanswer.
In view all tasks from test will be listed.

I've written part which reads from file and creates view, but I have problems with rece


making a simple search function, making the cursor jump to (or highlight) the word that is searched for
by Timur Asaliev in Programming Languages

I have now used way too long time, trying to figure out a problem, which I didn't think would be that hard.


Here is the deal:


I am writing a small application using C# and WPF.


I have a RichTextBox containing a FlowDocument.


I have added a small textbox and a button below my richtextbox.


The user then types in the word he/she wishes to


Ideas for Making Money by Making Things Out of Wood
by cynix in Hobbies, Games & Toys
If you are the creative type, a carpenter or are good with tools, making money by making things out of wood should be no problem. Some projects require few tools and are simple, while others are quite involved. Find your specialty and get to work. Give yourself a supplemental income or make enough to replace a lost paycheck by selling items made out of wood. FurniturePeople around the world use

Python - making counters, making loops?
by davidar in Programming Languages

I am having some trouble with a piece of code below:


Input: li is a nested list as below:


li = [['>0123456789 mouse gene 1
', 'ATGTTGGGTT/CTTAGTTG
', 'ATGGGGTTCCT/A
'], ['>9876543210 mouse gene 2
', 'ATTTGGTTTCCT
', 'ATTCAATTTTAAGGGGGGGG
']]

Using the function below, my desired output is simply the 2nd to the


making SQL more efficiency by making two queries into one instead of having a loop
by Mark W in Databases

I have the following code and was wondering how I could simplify it into one MYSQL statement


$sql = "SELECT sesionID
FROM `juegos_sesiones`
WHERE `usuarioID` = ".$_SESSION['MM_UserID'];
$query = mysql_query($sql, $cnx) or die(mysql_error());
//$row_rsPaises = mysql_fetch_assoc($rsPaises);
$exercises = mysql_num_rows($query);
echo $exercises;

Information About Doll Making & Clothes Making
by Jesse in Hobbies, Games & Toys
As early as the 1400s, the English were importing French dolls dressed in the latest Parisian fashions. Wood was one of the first materials used in doll making. Since most dolls were customarily clothed, the extremities were most appealing, especially the head. Carving wood developed into a sophisticated and expensive craft. As a result, doll makers throughout history explored a variety of materia

Making a Word document with PHP and making it read-only?
by Zivic in PHP

I use this guide to make Word documents using PHP and I use the HTML version in the guide since um using Linux:http://cutt.us/NBzX


Problem is that I need to generate read-only documents and Im having a headace making one...


Any ideas how to make the files read-only??


Thanks in advance


What Is the Difference Between Managerial Decision-Making & Strategic Decision-Making?
by tonix in Business
Companies make decisions throughout normal business operations. These businesses use financial, marketing and operational data to make the decisions. These decisions include both managerial decision-making, such as production scheduling or offering customer discounts, and strategic decision-making, which includes decisions such as business expansion or pursuing a merger. Companies need to understa

Art of Box Making
by Robby in Hobbies, Games & Toys
Small gift boxes can be made from a few pieces of paper and the proper folding techniques. These boxes are popular as they are homemade, easy to construct and, once you get good at them, can become little pieces of art. By following simple instructions on how to make these boxes, you'll get good at constructing them out of paper and then realize you can construct them out of just about anything th
TAGS : Making

3D Map Making
by General Mills in Computers
Maps are endlessly fascinating. Whether it is an ancient map of the Mediterranean or a modern map of London, a map gives you the world (or at least a slice of it) in miniature. For instance, a topographic map shows you exactly the elevation and shape of the area you are interested in. But one drawback of topographic maps is that it is often difficult for people (especially children) to translate i
TAGS : Making

Next



Privacy Policy - Copyrights Notice - Feedback - Report Violation - RSS 2017 © bighow.org All Rights Reserved .