» Home » making » Page 1
Making controller to look for properties from inheriting viewmodels - Test Making Engine
by Xander in Programming Languages

In my project I have to write the test engine, which will read test tasks from file, and make view, where people will answer:


One test has many tasks (list of tasks).
There are 4 types of tasks: radiobutton, checkbox, combobox, oneanswer.
In view all tasks from test will be listed.

I've written part which reads from file and creates view, but I have problems with rece


making a simple search function, making the cursor jump to (or highlight) the word that is searched for
by Timur Asaliev in Programming Languages

I have now used way too long time, trying to figure out a problem, which I didn't think would be that hard.


Here is the deal:


I am writing a small application using C# and WPF.


I have a RichTextBox containing a FlowDocument.


I have added a small textbox and a button below my richtextbox.


The user then types in the word he/she wishes to


Ideas for Making Money by Making Things Out of Wood
by cynix in Hobbies, Games & Toys
If you are the creative type, a carpenter or are good with tools, making money by making things out of wood should be no problem. Some projects require few tools and are simple, while others are quite involved. Find your specialty and get to work. Give yourself a supplemental income or make enough to replace a lost paycheck by selling items made out of wood. FurniturePeople around the world use

making SQL more efficiency by making two queries into one instead of having a loop
by Mark W in Databases

I have the following code and was wondering how I could simplify it into one MYSQL statement


$sql = "SELECT sesionID
FROM `juegos_sesiones`
WHERE `usuarioID` = ".$_SESSION['MM_UserID'];
$query = mysql_query($sql, $cnx) or die(mysql_error());
//$row_rsPaises = mysql_fetch_assoc($rsPaises);
$exercises = mysql_num_rows($query);
echo $exercises;

Making a Word document with PHP and making it read-only?
by Zivic in PHP

I use this guide to make Word documents using PHP and I use the HTML version in the guide since um using Linux:http://cutt.us/NBzX


Problem is that I need to generate read-only documents and Im having a headace making one...


Any ideas how to make the files read-only??


Thanks in advance


Python - making counters, making loops?
by davidar in Programming Languages

I am having some trouble with a piece of code below:


Input: li is a nested list as below:


li = [['>0123456789 mouse gene 1
', 'ATGTTGGGTT/CTTAGTTG
', 'ATGGGGTTCCT/A
'], ['>9876543210 mouse gene 2
', 'ATTTGGTTTCCT
', 'ATTCAATTTTAAGGGGGGGG
']]

Using the function below, my desired output is simply the 2nd to the


Information About Doll Making & Clothes Making
by Jesse in Hobbies, Games & Toys
As early as the 1400s, the English were importing French dolls dressed in the latest Parisian fashions. Wood was one of the first materials used in doll making. Since most dolls were customarily clothed, the extremities were most appealing, especially the head. Carving wood developed into a sophisticated and expensive craft. As a result, doll makers throughout history explored a variety of materia

What Is the Difference Between Managerial Decision-Making & Strategic Decision-Making?
by tonix in Business
Companies make decisions throughout normal business operations. These businesses use financial, marketing and operational data to make the decisions. These decisions include both managerial decision-making, such as production scheduling or offering customer discounts, and strategic decision-making, which includes decisions such as business expansion or pursuing a merger. Companies need to understa

Except OOP, what is making C++ better than C
by Jimmy G. in C & C++ & C#

Well that may sound like a troll question, but since C++ seems hard to fully master (and I never really knew STL was actually "part" of it), I wanted to know what are the disadvantages to use C instead of C++ when not relying much on OOP.


C++ can have a very much sophisticated syntax sometimes, which is kinda confusing me while trying to use OGRE3D for example...


PHP is making me use <?php instead of <?
by Damien in Development Tools & Services

My Apache/PHP installation is making me use <?php ... ?> instead of <? ... ?>. Where is this found in the configuration file so that I don't need to do the former? I'm assuming it's in php.ini, but not sure what it would be called.

TAGS : making instead

Next
Privacy Policy - Copyrights Notice - Feedback - Report Violation - RSS 2014 © bighow.org All Rights Reserved .